Working with Alignment Files (SAM/BAM/CRAM)
Overview
Pysam provides the AlignmentFile class for reading and writing SAM/BAM/CRAM formatted files containing aligned sequence data. BAM/CRAM files support compression and random access through indexing.
Opening Alignment Files
Specify format via mode qualifier:
- "rb" - Read BAM (binary)
- "r" - Read SAM (text)
- "rc" - Read CRAM (compressed)
- "wb" - Write BAM
- "w" - Write SAM
- "wc" - Write CRAM
import pysam
# Reading
samfile = pysam.AlignmentFile("example.bam", "rb")
# Writing (requires template or header)
outfile = pysam.AlignmentFile("output.bam", "wb", template=samfile)
Stream Processing
Use "-" as filename for stdin/stdout operations:
# Read from stdin
infile = pysam.AlignmentFile('-', 'rb')
# Write to stdout
outfile = pysam.AlignmentFile('-', 'w', template=infile)
Important: Pysam does not support reading/writing from true Python file objects—only stdin/stdout streams are supported.
AlignmentFile Properties
Header Information:
- references - List of chromosome/contig names
- lengths - Corresponding lengths for each reference
- header - Complete header as dictionary
samfile = pysam.AlignmentFile("example.bam", "rb")
print(f"References: {samfile.references}")
print(f"Lengths: {samfile.lengths}")
Reading Reads
fetch() - Region-Based Retrieval
Retrieves reads overlapping specified genomic regions using 0-based coordinates.
# Fetch specific region
for read in samfile.fetch("chr1", 1000, 2000):
print(read.query_name, read.reference_start)
# Fetch entire contig
for read in samfile.fetch("chr1"):
print(read.query_name)
# Fetch without index (sequential read)
for read in samfile.fetch(until_eof=True):
print(read.query_name)
Important Notes:
- Requires index (.bai/.crai) for random access
- Returns reads that overlap the region (may extend beyond boundaries)
- Use until_eof=True for non-indexed files or sequential reading
- By default, only returns mapped reads
- For unmapped reads, use fetch("*") or until_eof=True
Multiple Iterators
When using multiple iterators on the same file:
samfile = pysam.AlignmentFile("example.bam", "rb", multiple_iterators=True)
iter1 = samfile.fetch("chr1", 1000, 2000)
iter2 = samfile.fetch("chr2", 5000, 6000)
Without multiple_iterators=True, a new fetch() call repositions the file pointer and breaks existing iterators.
count() - Count Reads in Region
# Count all reads
num_reads = samfile.count("chr1", 1000, 2000)
# Count with quality filter
num_quality_reads = samfile.count("chr1", 1000, 2000, quality=20)
count_coverage() - Per-Base Coverage
Returns four arrays (A, C, G, T) with per-base coverage:
coverage = samfile.count_coverage("chr1", 1000, 2000)
a_counts, c_counts, g_counts, t_counts = coverage
AlignedSegment Objects
Each read is represented as an AlignedSegment object with these key attributes:
Read Information
query_name- Read name/IDquery_sequence- Read sequence (bases)query_qualities- Base quality scores (ASCII-encoded)query_length- Length of the read
Mapping Information
reference_name- Chromosome/contig namereference_start- Start position (0-based, inclusive)reference_end- End position (0-based, exclusive)mapping_quality- MAPQ scorecigarstring- CIGAR string (e.g., "100M")cigartuples- CIGAR as list of (operation, length) tuples
Important: cigartuples format differs from SAM specification. Operations are integers:
- 0 = M (match/mismatch)
- 1 = I (insertion)
- 2 = D (deletion)
- 3 = N (skipped reference)
- 4 = S (soft clipping)
- 5 = H (hard clipping)
- 6 = P (padding)
- 7 = = (sequence match)
- 8 = X (sequence mismatch)
Flags and Status
flag- SAM flag as integeris_paired- Is read paired?is_proper_pair- Is read in a proper pair?is_unmapped- Is read unmapped?mate_is_unmapped- Is mate unmapped?is_reverse- Is read on reverse strand?mate_is_reverse- Is mate on reverse strand?is_read1- Is this read1?is_read2- Is this read2?is_secondary- Is secondary alignment?is_qcfail- Did read fail QC?is_duplicate- Is read a duplicate?is_supplementary- Is supplementary alignment?
Tags and Optional Fields
get_tag(tag)- Get value of optional fieldset_tag(tag, value)- Set optional fieldhas_tag(tag)- Check if tag existsget_tags()- Get all tags as list of tuples
for read in samfile.fetch("chr1", 1000, 2000):
if read.has_tag("NM"):
edit_distance = read.get_tag("NM")
print(f"{read.query_name}: NM={edit_distance}")
Writing Alignment Files
Creating Header
header = {
'HD': {'VN': '1.0'},
'SQ': [
{'LN': 1575, 'SN': 'chr1'},
{'LN': 1584, 'SN': 'chr2'}
]
}
outfile = pysam.AlignmentFile("output.bam", "wb", header=header)
Creating AlignedSegment Objects
# Create new read
a = pysam.AlignedSegment()
a.query_name = "read001"
a.query_sequence = "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
a.flag = 0
a.reference_id = 0 # Index into header['SQ']
a.reference_start = 100
a.mapping_quality = 20
a.cigar = [(0, 35)] # 35M
a.query_qualities = pysam.qualitystring_to_array("IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII")
# Write to file
outfile.write(a)
Converting Between Formats
# BAM to SAM
infile = pysam.AlignmentFile("input.bam", "rb")
outfile = pysam.AlignmentFile("output.sam", "w", template=infile)
for read in infile:
outfile.write(read)
infile.close()
outfile.close()
Pileup Analysis
The pileup() method provides column-wise (position-by-position) analysis across a region:
for pileupcolumn in samfile.pileup("chr1", 1000, 2000):
print(f"Position {pileupcolumn.pos}: coverage = {pileupcolumn.nsegments}")
for pileupread in pileupcolumn.pileups:
if not pileupread.is_del and not pileupread.is_refskip:
# Query position is the position in the read
base = pileupread.alignment.query_sequence[pileupread.query_position]
print(f" {pileupread.alignment.query_name}: {base}")
Key attributes:
- pileupcolumn.pos - 0-based reference position
- pileupcolumn.nsegments - Number of reads covering position
- pileupread.alignment - The AlignedSegment object
- pileupread.query_position - Position in the read (None for deletions)
- pileupread.is_del - Is this a deletion?
- pileupread.is_refskip - Is this a reference skip (N in CIGAR)?
Important: Keep iterator references alive. The error "PileupProxy accessed after iterator finished" occurs when iterators go out of scope prematurely.
Coordinate System
Critical: Pysam uses 0-based, half-open coordinates (Python convention):
- reference_start is 0-based (first base is 0)
- reference_end is exclusive (not included in range)
- Region from 1000-2000 includes bases 1000-1999
Exception: Region strings in fetch() and pileup() follow samtools conventions (1-based):
# These are equivalent:
samfile.fetch("chr1", 999, 2000) # Python style: 0-based
samfile.fetch("chr1:1000-2000") # samtools style: 1-based
Indexing
Create BAM index:
pysam.index("example.bam")
Or use command-line interface:
pysam.samtools.index("example.bam")
Performance Tips
- Use indexed access when querying specific regions repeatedly
- Use
pileup()for column-wise analysis instead of repeated fetch operations - Use
fetch(until_eof=True)for sequential reading of non-indexed files - Avoid multiple iterators unless necessary (performance cost)
- Use
count()for simple counting instead of iterating and counting manually
Common Pitfalls
- Partial overlaps:
fetch()returns reads that overlap region boundaries—implement explicit filtering if exact boundaries are needed - Quality score editing: Cannot edit
query_qualitiesin place after modifyingquery_sequence. Create a copy first:quals = read.query_qualities - Missing index:
fetch()withoutuntil_eof=Truerequires an index file - Thread safety: While pysam releases GIL during I/O, comprehensive thread-safety hasn't been fully validated
- Iterator scope: Keep pileup iterator references alive to avoid "PileupProxy accessed after iterator finished" errors